deonceee2944 deonceee2944

03-05-2021
Mathematics

contestada

The sum of three numbers is 84, the second number is 2 times the 3rd , the first number is 8 more than the 3rd. What are the numbers

Respuesta :

clarch19 clarch19

04-05-2021

Answer:

a = 27

b = 38

c = 19

Step-by-step explanation:

a + b + c = 84

b = 2c

a = 8+c

8+c +2c+c = 84

4c + 8 = 84

4c = 76

c = 19

b = 2(19) = 38

a = 8 + 19 = 27

Answer Link

Otras preguntas

Solve for x. Assume that lines which appear tangent are tangent.

Which of these describes an endothermic process? When lithium is placed in water, the temperature of the container increases. The combustion of kerosene re

Fill in each blank with mitosis or meiosis. humans produce gametes by the process of __________________. a zygote becomes a fetus by the process of_____________

What is the pianist and the weary blues doing when he makes the piano moan with Melody

Each unit on the map represents 5 miles. What is the actual distance from Oceanfront to Seaside? Question 3 options: about 10 miles about 40 miles about 50 mile

What does this passage suggest about truman's reasons for declaring his doctrine? he thinks the doctrine is necessary to protect the united states as well as ot

How do you determine the type of ion charge any element will form based on its number of valence electrons?

The roman cubitus is an ancient unit of measure equivalent to 0.554m . Convert 2.22/m height of basketball forward to cubiti

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

For which of the following materials is necessary to stop a beta particle? A. Three feet of concrete B. Three inches of lead C. Thin pieces of wood D. Single s