caradangel7 caradangel7

03-02-2018
Mathematics

contestada

Write the number as an improperios fraction, 10 3/4

Respuesta :

AnimeBrainly AnimeBrainly

03-02-2018

10 3/4

10 x 4 = 40
40 + 3 = 43

43/4 is your answer

Hope this helps

Answer Link

Otras preguntas

Find the shear stress and the thickness of the boundary layer (a) at the center and (b) at the trailing edge of a smooth flat plate 10 ft wide and 2 ft long par

To write 11x2+17x−10 in factored form, Diego first listed pairs of factors of -10. (_+5)(_+-2) (_+2)(_+-5) (_+10)(_+-1) (_+1)(_+-10) Use what Diego star

Which type of reaction occurs in the following equation? 2NO2(g) + 2OH"(aq) —— NO2(aq) + NO, (aq) +H2O(1) a combination redox reaction a displacement redox reac

At what temperature Kelvin would 4.00 mol H2 in a 100 L container exert a pressure of 1.00 atm?

A series of strong storms opened a stream channel between two lakes. The western lake contains a large, diverse population of a species of minnow. The eastern l

y varies directly with x. If x=6 when y=30, determine y when x=8.

There are 150 students in the fifth grade in Washington Elementary School. 2/5 of the students like soccer best and 3/10 of them like basketball best. What frac

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

Our Town requires the audience to _____. Select all that apply.

.What occurs during a chemical reaction? Atoms of two or more elements are destroyed Atoms of two or more elements oppose one another Atoms of two or more eleme